Notes
This protocol is for folding a six-helix bundle with twelve 3prime 21mer handles of sequence
GCTCTGCAATCAACTTATCCC on the upstream side, and twelve 3prime 21mer handles of sequence CGTCCCCTTTTAACCCTAGAA on the downstream side.
There are four biotins interspersed along the length for capture on streptavidin-coated glass slides.
Pipetting Scheme
1. Hydrate staple strands for P0–P2 (IDT wells shipped dry)
-
Assume an average of 10 nmol per well for P0, P1 and 70 nmol per well for P2
-
Add 100 μL water to each DNA-containing well (see below) to achieve an nominal average concentration of 100 μM for P0, P1 and 250 μM for P2
-
P0A01–P0H12
-
P1A01–P1F04
-
P2A01–P2C04
-
-
Spin down plate
-
Incubate at room temperature for 10 min
-
Seal, vortex, spin down plate
2. Generate pre-stocks (pipet 10 μL from each well from P0, P1 or 4 μL from each well from P2)
-
.A_PS: P0A01–P1F04: light gray staple strands (160 total)
-
.B_PS: P2A01–P2C04: red and blue handle-bearing staple strands, purple biotinylated staple strands (28 total)
3. Generate working stock at 500 nM per strand
-
.0_WS: 160 μL .A_PS + 1
-
1.2 μL .B_PS + 28.9 μL water (200 μL total)
4. Aliquoting and distribution to teams
-
Add protocol steps here
5. Folding cocktail
6. Thermal ramps
6025-18h: 80°C 15 min → 60°C to 25°C over 18h
Results
1. Gel analysis
2% agarose gel; 1x TAE buffer, safeguard coloring; 120V for 45 min at RT
Lab notes
Protocol for gel electrophoresis: https://www.addgene.org/protocols/gel-electrophoresis/
TAE buffer + agarose in gel electrophoresis chamber
Add the safeguard coloring to the TAE buffer solution (300 ml to fill the entire chamber).
Insert 30uL of each in every other slot:
-
Assembled DNA ladder
-
DNA origami
-
Single Stranded (SS) DNA
All slots are filled, put electricity on. Wait 45 min to an hour.
2. TEM analysis
In John's lab!
DNA-PAINT (DNA-based point accumulation for imaging in nanoscale topography) is a super-resolution method that exploits programmable transient hybridization between short oligonucleotide strands, and allows multiplexed, single-molecule, single-label visualization with down to ~5-10 nm resolution. DNA-PAINT provides a method for structural characterisation of nucleic acid nanostructures with high spatial resolution and single-strand visibility.